[Français]

Time Frame:

We provide sequencing service from Monday to Friday. Results are available within 48 working hours. For high throughput, please contact us so that we may discuss the time required.

Automatic Sequencing Time Frame
Reception before 4:15 p.m.Sequences Available
MondayWednesday
TuesdayThursday
WednesdayFriday
ThursdayMonday
FridayTuesday
* Please note that we cannot receive samples on holidays, and that delivery rates will be delayed according to the holiday length.

Techniques:

The platform use the Sanger technique to perform the sequencing. A polymerase chain reaction (PCR) is first conducted using Big Dye 3.1 terminators and thermocyclers in either 96 or 384 reaction-well microplate format. The sequence is then determined by capillary electrophoresis. All the samples are analyzed using one of Applied Biosystems platform, the ABI 3730xl Data Analyzer. This 96-capillary sequencer applies electrophoresis, fluorescence, and optical techniques to simultaneously analyze the sequence of 96 samples for more than 800 nucleotides. The ABI 3730xl can attains a capacity of more than 1,000 samples per day for a total of one million nucleotides. Through years of work with our numerous researchers, we have developed the experience and flexibility needed to carry out projects comprising of a few to several thousand sequences. It currently takes us 48 hours to analyze projects.

Open an account

To submit samples, you have to open a user account first. To do so, please contact by e-mail the lab manager, Patrick Laplante, and include the following information:

If your researcher or your team aren't yet registered, an account will be necessary for them as well. The following information will be required:

Your user name will be sent to you by e-mail.

DNA preparation:

Please note that the better the quality of your DNA preparation are, the greater your chances of obtaining a good read length.

If you have a DNA with a high GC-content, a shRNA or a bisulfite DNA, please indicate it in the section Instruction Spéciale of the request form as well. GC-rich DNA sequences require distinct treatments to obtain a good sequence.

Primers:

Bank of free primers:
NameSequenceTm
SP6TATTTAGGTGACACTATAG-3'42ºC
T7pTAATACGACTCACTATAGG-3'45ºC
T7tGCTAGTTATTGCTCAGCGG-3'53ºC
T7-EEVAAGGCTAGAGTACTTAATACGA-3'50ºC
T3PCGAAATTAACCCTCACTAAAGG-3'51ºC
T5PCCCGAAAAGTGCCACCTG-3'57ºC
T5-FAATTTATTTGCTTTGTGAGC-3'47ºC
BGHTAGAAGGCACAGTCGAGG-3'54ºC
CMV-ForwardCGCAAATGGGCGGTAGGCGTG-3'64ºC
C-CMV-24TATTAGGACAAGGCTGGTGGGCAC-3'61ºC
N-CMV-30AATGTCGTAATAACCCCGCCCCGTTGACGC-3'67ºC
M13F-20GTAAAACGACGGCCAGT-3'53ºC
M13F-47CGCCAGGGTTTTCCCAGTCACGAC-3'64ºC
M13R-17CAGGAAACAGCTATGAC-3'47ºC
M13R-20GCGGATAACAATTTCACACAGG-3'55ºC
M13R-48AGCGGATAACAATTTCACACAGGA-3'57ºC
GLprimer2CTTTATGTTTTTGGCGTCTTCCA-3'54ºC
GLprimer4GGGTAGAATGGCGCTGGG-3'68ºC
RVprimer3CTAGCAAAATAGGCTGTCCC-3'53ºC
RVprimer4GACGATAGTCATGCCCCGCG-3'61ºC
EGFP-CforAGCACCCAGTCCGCCCTGAGC-3'67ºC
EGFP-NrevCGTCGCCGTCCAGCTC-3'59ºC
EGFPC2_fwdCCCAACGAGAAGCGCGATC-3'59ºC
EGFPC2_revCACTCAACCCTATCTCGGTC-3'55ºC
GFP-CforGGTCCTTCTTGAGTTTGTAAC-3'51ºC
GFP-FwGAAGCAGCACGACTTCTTC-3'54ºC
GFP-reverseGGGTAAGCTTTCCGTATGTAGC-3'55ºC
peGFPCCCTGCGGAGTTCG-3'49ºC
pEGFP-C-3TATGGCTGATTATGATCAGT-3'48ºC
pEGFP-C-5CATGGTCCTGCTGGAGTTCGTG-3'60ºC
pEGFP-N-3CGTCGCCGTCCAGCTCGACCAG-3'66ºC
pEGFP-N-5TGGGAGGTCTATATAAGCAGAG-3'53ºC
pcDNA3-4-REVCAACATAGTTAAGAATACCAGTC-3'49ºC
MT_ForwardCATCTCAGTGCAACTAAA-3'47ºC
5-AOX1GACTGGTTCCAATTGACAAGC -3'54ºC
Ac5ACACAAAGCCGCTCCATCAG-3'58ºC
CYC1GCGTGAATGTAAGCGTGAC-3'54ºC
DsRed1-CAGCTGGACATCACCTCCCACAACG-3'63ºC
EBVrevGTGGTTTGTCCAAACTCATC-3'52ºC
EF1a_fwdTCAAGCCTCAGACAGTGGTTC-3'57ºC
H1FTGTTCTGGGAAATCACCATA-3'51ºC
HA-reverseGCGTAGTCTGGGACGTCGTATGGGTA-3'63ºC
hGH-pA-RCCAGCTTGGTTCCCAATAGA-3'54ºC
Lambda-t0GGTCATTACTGGAGTCTTG-3'50ºC
pGEXfw-courtGGCAAGCCACGTTTGGTG-3'58ºC
pGEXrv-courtGAGCTGCATGTGTCAGAGG-3'56ºC
pGEXfw-longGGGCTGGCAAGCCACGTTTGGTG-3'66ºC
pGEXrv-longCCGGGAGCTGCATGTGTCAGAGG-3'64ºC
pJETFCGACTCACTATAGGGAGAGCGGC-3'61ºC
pJETRAAGAACATCGATTTTCCATGGCAG-3'56ºC
pMSCV-3primeGAGACGTGCTACTTCCATTTGTC-3'56ºC
pMSCV-5primeCCCTTGAACCTCCTCGTTCGACC-3'61ºC
PolyhedrinAAATGATAACCATCTCGC-3'47ºC
Poly-TTTTTTTTTTTTTTTTTTTTTTTTT(A/C/G)-3'42ºC
PQE-RevGTTCTGAGGTCATTACTGG-3'50ºC
RSV-fwdCATGCCGATTGGTGGAAGTAAG-3'56ºC
S-tagGAACGCCAGCACATGGACA-3'58ºC
SV40pA-RGAAATTTGTGATGCTATTGC-3'48ºC
SV40pro-FTATTTATGCAGAGGCCGAGG-3'54ºC
SV40revGGTATGGCTGATTATGATC-3'47ºC
TypeIII-IVCGGATAACAATTTCACACAG-3'49ºC
V5_C-termACCGAGGAGAGGGTTAGGGAT-3'59ºC
Tet-pLKO-neo-FGGCAGGGATATTCACCATTATCGTTTCAGA-3'60ºC
3-ADAGATGGTGCACGATGCACAG-3'58ºC
3-DNABDTTTTCGTTTTAAAACCTAAGAGTC-3'49ºC
hU6-FGAGGGCCTATTTCCCATGATT-3'54ºC
pASK-fwdGAGTTATTTTACCACTCCCT-3'49ºC
pASK-revCGCAGTAGCGGTAAACG-3'54ºC
IRES-FTGGCTCTCCTCAAGCGTATT-3'56ºC
IRES-RCCTCACATTGCCAAAAGACG-3'55ºC
LOK1-5GACTATCATATGCTTACCGT-3'50ºC
pENTR-FCTACAAACTCTTCCTGTTAGTTAG-3'51ºC
pENTR-RATGGCTCATAACACCCCTTG-3'55ºC
* If your universal primer is not on this list, we would be pleased to synthesize it and add it.

Shipping's rules:

Please ensure that your samples do not arrive here on the weekends or holidays.

Mailing address: